April 18, 2021

DeDaL: Cytoscape 3 app for producing and morphing data-driven and structure-driven network layouts.

Visualization and molecular profiling data analysis together with biological tissue can provide new mechanistic insight into the biological function. At present, it is possible to visualize high-throughput of data over the network layout has been determined, but they are not always suitable for the tasks of data analysis are given. A network layout based simultaneously on the network structure and associated multidimensional data may be advantageous for data visualization and analysis in some cases.

We develop Cytoscape application, which allows to build a biological network layout based on data from the molecular profile is imported as the values ​​of the attribute node. Dedal is 3 Cytoscape application, which uses an algorithm of linear and non-linear dimension reduction for network layout generate data-driven based on the multidimensional data (usually the expression of genes). tools Dedal some data pre-processing and post-processing layout step as a continuous morphing between two arbitrary network layout and align the network layout with respect to each other by rotating and mirroring.

The combination of all of these functions facilitate the creation of the network layout insight which represents both structural network features and patterns of correlations in multivariate data. We demonstrate the added value of the application Dedal in several practical applications, including tissue samples large protein-protein interactions.

DeDaL: Cytoscape 3 app for producing and morphing data-driven and structure-driven network layouts.
DeDaL: Cytoscape 3 app for producing and morphing data-driven and structure-driven network layouts.

Detection of miRNA regulatory effects on triple negative breast cancer transcriptome.

Identify key microRNAs (miRNAs) contributing to the origin and development of certain diseases is the focus of much recent research. We introduce here the rank-based algorithms for detecting miRNA regulatory activity in cancer tissue samples revealed that combining the measurements of gene and the expression levels of miRNA and target sequence-based prediction. This method is designed to detect modest but coordinated changes in expression of the target gene-sequence predicted based. We apply an algorithm to a cohort of 129 breast tumor and the healthy tissue and shown to be effective in identifying functional miRNAs may be involved in disease.

RMI1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

RMI1 Antibody

DF12724 200ul
EUR 304
Description: RMI1 Antibody detects endogenous levels of RMI1.

RMI1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti- RMI1 antibody

FNab07321 100µg
EUR 585
  • Immunogen: RMI1, RecQ mediated genome instability 1, homolog(S. cerevisiae)
  • Uniprot ID: Q9H9A7
  • Gene ID: 80010
  • Research Area: Metabolism
Description: Antibody raised against RMI1

RMI1 Rabbit pAb

A4991-100ul 100 ul
EUR 308

RMI1 Rabbit pAb

A4991-200ul 200 ul
EUR 459

RMI1 Rabbit pAb

A4991-20ul 20 ul
EUR 183

RMI1 Rabbit pAb

A4991-50ul 50 ul
EUR 223

RMI1 Polyclonal Antibody

A67578 100 µg
EUR 570.55
Description: The best epigenetics products

RMI1 Blocking Peptide

33R-1953 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RMI1 antibody, catalog no. 70R-5555

RMI1 Polyclonal Antibody

30629-100ul 100ul
EUR 252

RMI1 Polyclonal Antibody

30629-50ul 50ul
EUR 187

RMI1 cloning plasmid

CSB-CL875699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgaatgtgactagtattgcattaagagctgaaacttggcttttagctgcatggcatgttaaagtacctccgatgtggctggaagcttgtattaactggattcaagaagaaaataataatgttaacttgagtcaggcccaaatgaataaacaagtgtttgagcagtggctcctta
  • Show more
Description: A cloning plasmid for the RMI1 gene.

RMI1 Blocking Peptide

DF12724-BP 1mg
EUR 195

Anti-RMI1 antibody

PAab07321 100 ug
EUR 412

Anti-RMI1 antibody

STJ25361 100 µl
EUR 277

RMI1 Polyclonal Conjugated Antibody

C30629 100ul
EUR 397

Mouse RMI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RMI1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-14504h 96 Tests
EUR 824


ELI-20347b 96 Tests
EUR 928


ELI-20348c 96 Tests
EUR 928


EF002488 96 Tests
EUR 689

Mouse Rmi1 ELISA KIT

ELI-38860m 96 Tests
EUR 865

RMI1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RMI1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RMI1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RMI1. Recognizes RMI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RMI1 Recombinant Protein (Human)

RP026503 100 ug Ask for price

pCMV-SPORT6-RMI1 Plasmid

PVT16836 2 ug
EUR 325

RMI1 Recombinant Protein (Mouse)

RP168335 100 ug Ask for price

RMI1 Recombinant Protein (Mouse)

RP168338 100 ug Ask for price

RMI1 Polyclonal Antibody, HRP Conjugated

A67579 100 µg
EUR 570.55
Description: kits suitable for this type of research

RMI1 Polyclonal Antibody, FITC Conjugated

A67580 100 µg
EUR 570.55
Description: fast delivery possible

RMI1 Polyclonal Antibody, Biotin Conjugated

A67581 100 µg
EUR 570.55
Description: reagents widely cited

RMI1 ORF Vector (Human) (pORF)

ORF008835 1.0 ug DNA
EUR 95

Rmi1 ORF Vector (Mouse) (pORF)

ORF056113 1.0 ug DNA
EUR 506

Rmi1 ORF Vector (Mouse) (pORF)

ORF056114 1.0 ug DNA
EUR 506

RMI1 sgRNA CRISPR Lentivector set (Human)

K1827701 3 x 1.0 ug
EUR 339

Rmi1 sgRNA CRISPR Lentivector set (Mouse)

K4476601 3 x 1.0 ug
EUR 339

RMI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1827702 1.0 ug DNA
EUR 154

RMI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1827703 1.0 ug DNA
EUR 154

RMI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1827704 1.0 ug DNA
EUR 154

Rmi1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4476602 1.0 ug DNA
EUR 154

Rmi1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4476603 1.0 ug DNA
EUR 154

Rmi1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4476604 1.0 ug DNA
EUR 154

RMI1 Protein Vector (Human) (pPB-C-His)

PV035337 500 ng
EUR 329

RMI1 Protein Vector (Human) (pPB-N-His)

PV035338 500 ng
EUR 329

RMI1 Protein Vector (Human) (pPM-C-HA)

PV035339 500 ng
EUR 329

RMI1 Protein Vector (Human) (pPM-C-His)

PV035340 500 ng
EUR 329

RMI1 Protein Vector (Mouse) (pPB-C-His)

PV224450 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPB-N-His)

PV224451 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-HA)

PV224452 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-His)

PV224453 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPB-C-His)

PV224454 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPB-N-His)

PV224455 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-HA)

PV224456 500 ng
EUR 603

RMI1 Protein Vector (Mouse) (pPM-C-His)

PV224457 500 ng
EUR 603

Rmi1 3'UTR GFP Stable Cell Line

TU167918 1.0 ml Ask for price

RMI1 3'UTR Luciferase Stable Cell Line

TU019953 1.0 ml
EUR 1394

Rmi1 3'UTR Luciferase Stable Cell Line

TU117918 1.0 ml Ask for price

RMI1 3'UTR GFP Stable Cell Line

TU069953 1.0 ml
EUR 1394

Rmi1 3'UTR Luciferase Stable Cell Line

TU219470 1.0 ml Ask for price

Rmi1 3'UTR GFP Stable Cell Line

TU269470 1.0 ml Ask for price

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

abx145095-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

abx029125-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

abx029125-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody

abx237321-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Rmi1 ELISA Kit| Mouse RecQ-mediated genome instability protein

EF015197 96 Tests
EUR 689

RMI1 ELISA Kit| Bovine RecQ-mediated genome instability protein

EF011502 96 Tests
EUR 689

RMI1 ELISA Kit| chicken RecQ-mediated genome instability protei

EF012342 96 Tests
EUR 689

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RecQ-Mediated Genome Instability Protein 1 (RMI1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E02R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E02R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E02R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse RecQ mediated genome instability protein 1(RMI1) ELISA kit

E03R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse RecQ mediated genome instability protein 1(RMI1) ELISA kit

E03R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse RecQ mediated genome instability protein 1(RMI1) ELISA kit

E03R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RecQ mediated genome instability protein 1(RMI1) ELISA kit

E04R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RecQ mediated genome instability protein 1(RMI1) ELISA kit

E04R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit RecQ mediated genome instability protein 1(RMI1) ELISA kit

E04R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ mediated genome instability protein 1(RMI1) ELISA kit

E01R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ mediated genome instability protein 1(RMI1) ELISA kit

E01R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ mediated genome instability protein 1(RMI1) ELISA kit

E01R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E06R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E06R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat RecQ mediated genome instability protein 1(RMI1) ELISA kit

E06R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E07R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E07R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E07R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog RecQ mediated genome instability protein 1(RMI1) ELISA kit

E08R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog RecQ mediated genome instability protein 1(RMI1) ELISA kit

E08R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog RecQ mediated genome instability protein 1(RMI1) ELISA kit

E08R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey RecQ mediated genome instability protein 1(RMI1) ELISA kit

E09R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey RecQ mediated genome instability protein 1(RMI1) ELISA kit

E09R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey RecQ mediated genome instability protein 1(RMI1) ELISA kit

E09R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human RecQ-mediated genome instability protein 1 (RMI1) ELISA Kit

abx382828-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse RecQ-mediated genome instability protein 1 (RMI1) ELISA Kit

abx389563-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RMI1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1827705 3 x 1.0 ug
EUR 376

Rmi1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4476605 3 x 1.0 ug
EUR 376

Guinea pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E05R0414-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E05R0414-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig RecQ mediated genome instability protein 1(RMI1) ELISA kit

E05R0414-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig RecQ mediated genome instability protein 1(RMI1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RMI1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1827706 1.0 ug DNA
EUR 167

RMI1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1827707 1.0 ug DNA
EUR 167

RMI1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1827708 1.0 ug DNA
EUR 167

Rmi1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4476606 1.0 ug DNA
EUR 167

Rmi1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4476607 1.0 ug DNA
EUR 167

Rmi1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4476608 1.0 ug DNA
EUR 167

This observation has been validated using breast cancer datasets publicly available independent of The Cancer Genome Atlas. We focus on triple negative breast cancer subtypes to highlight potentially relevant miRNAs in these tumor subtypes. For those miRNAs were identified as potential regulators, we characterize the function of target genes affected by enrichment analysis. In two independent datasets, targets affected are not always the same, but displays a similar enriched categories, including breast cancer-related processes such as cell substrate adherens junction, regulation of cell migration, nuclear pore complex and the integrin pathway.

Leave a Reply

Your email address will not be published. Required fields are marked *